paul says that i the number 6367 one 6 is 10 times as great as the other 6 is he correct why or why not?

5) these are organisms where the genetic material is not bound by a nucleus. they are usually unicellular.

Coat color in cats is determined by genes at several different loci. at one locus on the x chromosome, one allele (x ) encodes black fur and another allele (xo) encodes orange fur. females can be black (x x ), orange (xoxo), or a mixture of orange and black called tortoiseshell (x xo). males are either black (x y) or orange (xoy). bill has a female tortoiseshell cat named patches. one night, patches escapes from bill\'s house, spends the night out, and mates with a stray male. patches later gives birth to the following kittens: one orange male, one black male, two tortoiseshell females, and one orange female. what are the genotypes of patches, the stray male, and the kittens?

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?