subject
Biology, 29.07.2021 05:30 puppystar159p51vxk

Match the following terms and definitions. 1. any pair of chromosomes other than the sex chromosomes
3
diploid
2. idea that the behavior of chromosomes explains the inheritance of genes
allele
3. having chromosomes in homologous pairs
mutation
4. having one half of each pair of homologous chromosomes
1
autosome
5. alternative form of a specific recessive or dominant gene
gene
6. a change that has occurred in the genetic information code
4
haploid
7. a segment of DNA that contains the information for making proteins
2
chromosome theory

ansver
Answers: 3

Another question on Biology

question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 12:00
Which of the following is not associated with invasive species?
Answers: 1
question
Biology, 22.06.2019 18:50
Can nonrenewable resources be used sustainably?
Answers: 1
question
Biology, 22.06.2019 19:30
On a backpacking trip, kenny hikes all day at a steady pace, covering 30 kilometers and burning 4000 calories. at the school track, janelle runs the 100-meter sprint in 13.5 seconds, burning 10 calories. afterward, janelle’s leg muscles are aching and she is breathing hard, while kenny maintains normal breathing all day, even though he burns 400 times more calories than janelle. which two statements offer the best explanation for this phenomenon? a. if the aerobic pathway—cellular respiration—cannot meet the energy demand, then the anaerobic pathway—lactic acid fermentation—starts up, resulting in lactic acid buildup and "oxygen debt." b. aerobic cellular respiration produces more energy, but its use is limited because of lactic acid buildup in the muscles and the resulting "oxygen debt." c. after about 90 seconds of intense exercise, the muscles become depleted of oxygen, and anaerobic respiration can no longer function to produce atp, resulting in "oxygen debt." d. the rate of energy demand determines how the muscles will obtain energy, either from cellular respiration or from lactic acid fermentation if not enough oxygen is present.
Answers: 3
You know the right answer?
Match the following terms and definitions. 1. any pair of chromosomes other than the sex chromosome...
Questions
question
Mathematics, 23.07.2019 23:30
question
Chemistry, 23.07.2019 23:30
Questions on the website: 13722362