DNA is referred to as a, meaning that it has
strands that aretogether.

Dermal tissue in plants stores 1.extra food 2.transports water and nutrients 3.transports waste materials 4.is similar to epithelial cells in animals

Pentane with molecular formula c5h12, exists in three isomeric forms. one shows linear carbon chains, another has one -ch3 groups present on the third carbon atom, and the third has two -ch3 groups present on the second carbon atom. what types of isomers are these? a. geometric isomers b. structural isomers c. halotropic isomers

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?