subject
Biology, 09.07.2021 01:30 aletadaboss

1. the movement of water into area with high concentration of dissolved solutes in order to equal out the solute concentration is a) concentration
b) diffusion
c) osmosis
d) blood oxygen level​

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 07:00
Give an example of a trait that is controlled by more than one gene.
Answers: 1
question
Biology, 22.06.2019 07:30
What is one way intensive agriculture can contribute to climate change? a. tree loss to agriculture increases earth's albedo b. livestock manure absorbs greenhouse gases c. large herds of livestock release greenhouse gases d. fewer trees are available to replenish petroleum stores appex
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 17:50
They live on every continent except antarctica
Answers: 2
You know the right answer?
1. the movement of water into area with high concentration of dissolved solutes in order to equal ou...
Questions
question
Advanced Placement (AP), 18.10.2020 05:01
question
Social Studies, 18.10.2020 05:01
question
Mathematics, 18.10.2020 05:01
question
English, 18.10.2020 05:01
question
Mathematics, 18.10.2020 05:01
Questions on the website: 13722363