Biology, 09.07.2021 01:30 aletadaboss
1. the movement of water into area with high concentration of dissolved solutes in order to equal out the solute concentration is
a) concentration
b) diffusion
c) osmosis
d) blood oxygen level​
Answers: 1
Biology, 22.06.2019 07:00
Give an example of a trait that is controlled by more than one gene.
Answers: 1
Biology, 22.06.2019 07:30
What is one way intensive agriculture can contribute to climate change? a. tree loss to agriculture increases earth's albedo b. livestock manure absorbs greenhouse gases c. large herds of livestock release greenhouse gases d. fewer trees are available to replenish petroleum stores appex
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
1. the movement of water into area with high concentration of dissolved solutes in order to equal ou...
Biology, 18.10.2020 05:01
Advanced Placement (AP), 18.10.2020 05:01
Social Studies, 18.10.2020 05:01
Computers and Technology, 18.10.2020 05:01
Mathematics, 18.10.2020 05:01
Health, 18.10.2020 05:01
English, 18.10.2020 05:01
Social Studies, 18.10.2020 05:01
Mathematics, 18.10.2020 05:01
History, 18.10.2020 05:01