subject
Biology, 24.06.2021 18:50 liv467

Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provide the 6 DNA codons that would be read following the mutation. Are they the same as the original 6 DNA codons that would have been read

ansver
Answers: 2

Another question on Biology

question
Biology, 21.06.2019 20:40
Question 11 which of the following personal health practices should a person follow to reduce the risk of skin cancer? avoid staying outdoors when the sun is strongest. consume antibiotics to prevent bacterial attacks. wash hands frequently to maintain proper hygiene. have a balanced diet and exercise regularly. question 12 a student wants to compare how easily a metal and a plastic spoon of the same temperature can transfer thermal energy. which of the following activities should the student perform? measure the effort required to bend each spoon. place an ice cube on each spoon and record the rate of melting of the cubes. place the spoons at room temperature and record the change in temperature of each. measure the change in weight of the spoons after placing them in the freezer for a few minutes. question 13 the characteristics of certain cell divisions are described in the following table. cell division characteristics characteristic description 1 forms diploid cells 2 creates sex cells, or gametes which type(s) of cell division do the two characteristics represent? both characteristics represent meiosis. both characteristics represent mitosis. characteristic 1 represents meiosis and characteristic 2 represents mitosis. characteristic 1 represents mitosis and characteristic 2 represents meiosis. question 14 which of the following adaptations in wooly mammoths could have best prevented their extinction? shedding of fur darker color of fur growth of an extra layer of fur increase in the thickness of fur question 15 maria and ben are both suffering from a hereditary disease, as described in the following table. description of disease patient description maria blood cells get stuck in blood vessels, causing painful attacks ben hemoglobin is abnormal due to curved shape of red blood cells which disease(s) are maria and ben suffering from? both are suffering from type 1 diabetes. both are suffering from sickle cell anemia. maria is suffering from sickle cell anemia and ben from type 1 diabetes. maria is suffering from type 1 diabetes and ben from sickle cell anemia. question 16 which of the following icons is used to represent a female carrier of a disease? a half-filled circle a half-filled square a completely filled circle a completely filled square question 17 joe sowed seeds of a plant in two different types of soil in separate pots. she added the same amount of fertilizer to the pots. she then placed the pots in the sun and recorded their growth after four days. what is the independent variable in the study? duration of growth amount of fertilizer growth of seeds type of soil question 18 philip has curly hair and his sister has straight hair. which of the following explains why philip and his sister have different hair types? both children received the same hair coding gene from their mother. both children received the same hair coding gene from their father. their mother was exposed to different environments before their births. the children each received different genes from their parents. question 19 which statement is most likely correct about species which cannot adapt? they become extinct. their immunity increases. their population increases. they produce more offspring. question 20 four animals live in the arctic. their characteristics are described in the following table. animal characteristics a long tail b small feet c black fur d white skin which animal is least likely to be captured by its enemies? animal a animal b animal c animal d
Answers: 3
question
Biology, 22.06.2019 03:30
What is the correct answer for the process of water eroding soil? rills, sheet erosion, gullies sheet erosion, rill, gullies gullies, rills, sheet erosion sheet erosion, gullies, rills
Answers: 1
question
Biology, 22.06.2019 06:20
Select the correct answer from each drop-down menu proteins are
Answers: 1
question
Biology, 22.06.2019 17:50
Describe the trends in electron configuration in the periodic table by selecting the terms from the drop down menus
Answers: 1
You know the right answer?
Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that re...
Questions
question
Mathematics, 05.05.2020 09:08
question
Advanced Placement (AP), 05.05.2020 09:09
question
Mathematics, 05.05.2020 09:09
question
Mathematics, 05.05.2020 09:09
Questions on the website: 13722360