subject
Biology, 22.06.2021 09:10 demetricejames

What is the cell?
Which is the difference between animal and plant cells?

ansver
Answers: 2

Another question on Biology

question
Biology, 21.06.2019 15:00
In familial hypercholesterolemia individuals homozygous for the allele causing the disorder completely lack receptors on liver cells that take up cholesterol from the blood stream. heterozygous have one-half the number of receptors while individuals homozygous for the normal allele are phenotypically normal. this is an example of a.epistasis b.complete dominance c. incomplete dominance d. codominance
Answers: 2
question
Biology, 22.06.2019 03:00
Discuss the functions of epithelial connective nerviud and muscular tissues
Answers: 3
question
Biology, 22.06.2019 09:00
What happens when water’s salinity increases? mass decreases. freezing point decreases. buoyancy of objects decreases. the amount of dissolved minerals decreases.
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
What is the cell?
Which is the difference between animal and plant cells?...
Questions
question
Mathematics, 29.08.2019 14:10
Questions on the website: 13722363