Write the tRNA sequence for the given strand of mRNA 7. AGGUCAUGCAUGGGCAUGCAU 8.AGAGAUUCAGCUAGCACGAUA I​

What is the difference between self-pollination and cross-pollination? question 2 options: self-pollination leads to the creation of a fruit. cross-pollination does not. during cross-pollination, ovules are carried from one plant to another plant.. during self-pollination the ovules stay on the same plant. during cross-pollination, ovules are carried from one plant to another plant.. during self-pollination the ovules stay on the same plant. during cross-pollination the pollen grains are carried from one plant to another plant. during self-pollination the pollen and ovules are from the same plant. during cross-pollination, the pollen grains travel from the stigma to the anthers. during self-pollination, the pollen grains travel from the anthers to the stigma.

Match with o for organic and i for inorganic for each compound

Which event would lead to primary succession of a forest?