Write the tRNA sequence for the given strand of mRNA AGGUCAUGCAUGGGCAUGCAU

instead of copying and pasting things off of tests or work done on computer which im sure you did, try and read over the question carefully

bacteria could be both, harmful and to us. harmful bacteria could make us sick and probably even by getting the chances of getting a disease, but good bacteria fight it off with your immune system. there is always bacteria everywhere we go. we need to make sure to wash our hands after using the restroom, before eating, after eating, after petting an animal too. so you see, bacteria is everywhere and is harmful or . i hope this . : ) : ) : )