Salmon are predators that hunt smaller fish like herring or small shrimp-like krill. Krill predate on phytoplankton. Phytoplankton are microscopic plants that live in Puget Sound. a. Use this information to draw an energy pyramid and place each organism in the correct trophic level.

b. If each pound of phytoplankton represented 1 joule of energy, how many pounds of phytoplankton would give 1 joule of energy to a salmon. Show your math and include the energy (and pounds) available in each trophic level.
​

What are some things that limit population growth?

Where can dna be found in a prokaryotic cell

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?