Based on the dichotomous key, what type of tree did this leaf come from?
Horse chestnut
Gin...
![subject](/tpl/images/cats/biologiya.png)
Biology, 06.05.2021 23:20 trodrickwilliams2019
Based on the dichotomous key, what type of tree did this leaf come from?
Horse chestnut
Ginkgo
Honey Locust
Black maple
![ansver](/tpl/images/cats/User.png)
Answers: 1
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 19:00
2. in dragons, a gene on chromosome 1 codes for wing color and a gene on chromosome 2 codes for body color. draw out the stages of meiosis for these two chromosomes from a dragon that is heterozygous for both traits. define your alleles. what are all the possible allele combinations of the gametes produced?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 06:30
Zoo geographic regions are characterized by the presence of specific groups of animals these regions are determined by the taxonomic or phylogenetic relationships of animals. the map shows the zoogeographic regions proposed by the naturalist alfred russel wallace in 1876. the similarities of organisms in which two areas numbered above provide the best evidence for common ancestry between the organisms in both locations ?
Answers: 3
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Questions
![question](/tpl/images/cats/en.png)
English, 18.03.2021 02:20
![question](/tpl/images/cats/fizika.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 18.03.2021 02:20
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 18.03.2021 02:20
![question](/tpl/images/cats/mat.png)
Mathematics, 18.03.2021 02:20
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 18.03.2021 02:20
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 18.03.2021 02:20