1.Consider the model above compare the DNA sequence of the model and abnormal CFTR gene explain the differences and similarities between the two. 2. Explain what caused the abnormal structure of CFTR protein.
3. Considering the structure of the mutant protein channel do you think it can perform the same function as a normal CFTR protein channel explain why or why not?

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

What are 3 reasons that natural selection occurs

Which line in the graph above best illustrates an effect of the carbon dioxide level in the blood on breathing rate before, during and after a period of exercise? 1.b,2.c,3.a,4.d