In sweet pea, gene c is responsible for color production and gene p is responsible for the purple color pigment. both of them are located on two different loci on different chromosomes. the flowers will be purple only when the plant has the genotypes as c_p_. no color will be produced with genotypes: ccpp, ccpp, ccpp, ccpp. thus, gene c controls the expression of gene p. what pattern of inheritance is exhibited here?

The reactions that occur in the ribosome, where amino acids are combined to form proteins are anabolic or catabolic?

According the inverse square law, doubling the distance from the source of the sound, a speaker, for example, will drop the sound 6 db each time. if you were standing in the back of an auditorium, 32 feet away from a speaker not using any amplification, would you be able to hear a speaker clearly? why or why not?

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?