subject
Biology, 15.01.2020 18:31 Yuii

How can viruses be detected in your body?

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 05:30
The vaccine in a flu shot contains weakened flu viruses. how does a flu shot work with the immune system? a. it destroys lymphocytes. b. it destroys macrophages. c. it activates macrophages. d. it activates lymphocytes.
Answers: 3
question
Biology, 22.06.2019 08:00
This is a situation in which genes are attached to an organism's sex chromosomes; the sex of an organism influences the expression of a gene.
Answers: 2
question
Biology, 22.06.2019 10:00
In one or two well-crafted paragraphs in your laboratory journal, summarize the process in which normal cells become cancer cells. your paragraph(s) must include each of the terms listed below. underline each term in your writing:
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
How can viruses be detected in your body?...
Questions
Questions on the website: 13722363