subject
Biology, 21.09.2019 05:40 codie1103

Which plant system is affected when the xylem tissue is removed?
transport of water and minerals from the roots to the shoot system
transport of sugars from the leaves to the shoot system
transport of minerals from the leaves to the reproductive parts

ansver
Answers: 1

Another question on Biology

question
Biology, 21.06.2019 20:00
How does pregnancy begin? a) a placenta forms in the uterus b) a sperm reaches an egg in the fallopian tubec) the blastocyst differentiates into two cell types d) contractions begin in the uterine wallapex
Answers: 2
question
Biology, 21.06.2019 22:00
Amale bird-of-paradise uses a dance to attract mates in which it flaps its tail feathers on the ground and jumps around a potential female mate. a different male bird-of-paradise does a similar dance but it jumps around the female in the opposite direction. the female bird is only attracted to one style of dance, in one direction. this is an example of speciation.
Answers: 3
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 17:00
Label all the places where dna is located in the plant cell and in the animal cell. dna
Answers: 1
You know the right answer?
Which plant system is affected when the xylem tissue is removed?
transport of water and miner...
Questions
question
Mathematics, 20.08.2020 02:01
Questions on the website: 13722362