![subject](/tpl/images/cats/biologiya.png)
Biology, 02.09.2019 07:10 23lopezjimenezl
What does it mean to be a “carrier” for a trait? what would be the genotype of someone who is a carrier for passing on the trait of not being able to roll the tongue?
![ansver](/tpl/images/cats/User.png)
Answers: 1
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 08:00
Why did mendel use pea plants in his experiments? a. they have no alleles. b. they are haploid organisms. c. they reproduce quickly. d. they are all male.
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 08:50
Why is earth's outer core hotter than earth’s oceanic crust? earth’s oceanic crust is denser than earth’s outer core is. earth’s oceanic crust has lava flowing from the mantle. earth’s outer core has a composition of solid iron and nickel. earth’s outer core is deeper within earth than oceanic crust is.
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 09:00
Which of the following types of stars are dim but can have high surface temperatures? giants main sequence stars supergiants dwarfs
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
What does it mean to be a “carrier” for a trait? what would be the genotype of someone who is a car...
Questions
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 26.08.2019 20:10
![question](/tpl/images/cats/en.png)
English, 26.08.2019 20:10
![question](/tpl/images/cats/mat.png)
Mathematics, 26.08.2019 20:10
![question](/tpl/images/cats/mat.png)
Mathematics, 26.08.2019 20:10
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/fizika.png)
Physics, 26.08.2019 20:10
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/geografiya.png)
Geography, 26.08.2019 20:10
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/en.png)