Biology, 28.09.2019 08:00 4004JuCh18
24. carbon dioxide as a waste product produced by all the cells of your body. it leaves the cells and enters the blood that is passing by in the capillary. which of the following describes the pathway taken by carbon dioxide until it leaves the body?
(these all go left to right)
capillary- aorta- left atrium - left ventricle - lungs
capillary - vein - right atrium - right ventricle - lungs
capillary - aorta- right atrium- left atrium - lungs
capillary - vein- left atrium - left ventricle - lungs
Answers: 1
Biology, 21.06.2019 22:30
How do tides affect the organisms living in intertidal zones? a. no organisms live in intertidal zones due to the tumultuous environment. b. the mechanical forces of the waves keeps the organisms clean. c. only plants live in intertidal zones because the animals float away with the waves and never return. d. the mechanical forces of the waves can dislodge the organisms from their habitat.
Answers: 2
Biology, 22.06.2019 07:00
What molecules will be best used to compare different species with the exact same sequence of amino acids? why would two species have the same protein even if the molecules in question is different? (hint: transcription to translation to protein).
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 13:30
Which of these correctly describes the difference between processes that take place in prokaryotic and eukaryotic cells?
Answers: 1
24. carbon dioxide as a waste product produced by all the cells of your body. it leaves the cells an...
Computers and Technology, 29.05.2021 01:00
Computers and Technology, 29.05.2021 01:00
English, 29.05.2021 01:00
Physics, 29.05.2021 01:00
Social Studies, 29.05.2021 01:00
Computers and Technology, 29.05.2021 01:00
Arts, 29.05.2021 01:00
English, 29.05.2021 01:00