a. a scar is formed at the site.
Biology, 22.09.2019 02:30 kgflol5692
What happens in the proliferation stage of wound healing?
a. a scar is formed at the site.
b. blood clots to prevent further bleeding.
c. new blood vessels are formed at the site.
Answers: 2
Biology, 22.06.2019 03:30
Describe how a student should adjust the microscope to see the cells on a slide more clearly?
Answers: 1
Biology, 22.06.2019 09:40
Which statement is the best summary of the model? a-a series of aerobic and anaerobic reactions take place in cells b- the sun's energy moves through trophic levels in a food chain c-light energy is converted into stored chemical energy plants.d- food molecules are broken down in the cells if living things.
Answers: 1
Biology, 22.06.2019 11:30
Why do some dna fragments move farther than others during gel electrophoresis? a. because their shapes are different b. because they are different types of molecules c. because the samples are different colors d. because their masses are different
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
What happens in the proliferation stage of wound healing?
a. a scar is formed at the site.
a. a scar is formed at the site.
Computers and Technology, 07.08.2019 23:30
Computers and Technology, 07.08.2019 23:30
Computers and Technology, 07.08.2019 23:30
Computers and Technology, 07.08.2019 23:30
Computers and Technology, 07.08.2019 23:30
Computers and Technology, 07.08.2019 23:30
Computers and Technology, 07.08.2019 23:30