subject
Biology, 30.01.2020 17:45 Jasten

What are the 3 layers of earth and their volumes

ansver
Answers: 3

Another question on Biology

question
Biology, 21.06.2019 15:00
In familial hypercholesterolemia individuals homozygous for the allele causing the disorder completely lack receptors on liver cells that take up cholesterol from the blood stream. heterozygous have one-half the number of receptors while individuals homozygous for the normal allele are phenotypically normal. this is an example of a.epistasis b.complete dominance c. incomplete dominance d. codominance
Answers: 2
question
Biology, 21.06.2019 15:00
Which phrases describe an extrusive rock? check all that apply. fine texture cooled slowly small crystal size found deep underground different, easily observed minerals
Answers: 2
question
Biology, 22.06.2019 05:20
When a human or animal consumes food, the carbon in that food is most likely to be converted into which of the following elements? a. carbon remains carbon b. nitrogen c. oxygen d. hydrogen
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
What are the 3 layers of earth and their volumes...
Questions
Questions on the website: 13722367