![subject](/tpl/images/cats/biologiya.png)
Biology, 27.08.2019 12:30 skaterwolf1317
Some nonsedimentary rock are formed as a result of 1. solidification of molten material 2. evaporation and precipitation 3. cementation of particles 4. depositions of particles
![ansver](/tpl/images/cats/User.png)
Answers: 1
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 04:00
What is the name of the type of cell division that occurs in the prokaryotic cell cycle
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Label the steps for protein synthesis in order, beginning with the first steponce the protein is made, the gene for a particular trait is expressedmrna joins the ribosome, and the anticodons from trna join mrna to form a chain ofamino acidsrna polymerase unzips dna and free rna nucleotides join dna to form mrnav a chain of amino acids is formed from peptide bonds, creating a proteinmrna is transported from the nucleus of the cell to the ribosomes of the cell.
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 18:00
Select the correct answer. for their summer holiday, jane and her family are visiting places surrounding the mediterranean sea. which type of biome is jane and her family visiting? a. rainforest b. shrubland c. tundra d. coniferous forest reset next
Answers: 1
You know the right answer?
Some nonsedimentary rock are formed as a result of 1. solidification of molten material 2. evaporati...
Questions
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mkx.png)
Arts, 06.10.2020 18:01
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 06.10.2020 18:01
![question](/tpl/images/cats/istoriya.png)
History, 06.10.2020 18:01
![question](/tpl/images/cats/mat.png)
Mathematics, 06.10.2020 18:01
![question](/tpl/images/cats/informatica.png)
Computers and Technology, 06.10.2020 18:01
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 06.10.2020 18:01
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 06.10.2020 18:01
![question](/tpl/images/cats/istoriya.png)
History, 06.10.2020 18:01
![question](/tpl/images/cats/mat.png)
Mathematics, 06.10.2020 18:01
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 06.10.2020 18:01
![question](/tpl/images/cats/ap.png)
Advanced Placement (AP), 06.10.2020 18:01
![question](/tpl/images/cats/mat.png)
Mathematics, 06.10.2020 18:01
![question](/tpl/images/cats/istoriya.png)
History, 06.10.2020 18:01