subject
Biology, 19.04.2021 19:10 kirklandL

EASY POINTS
Why is "genetic blueprint" an appropriate description for DNA?

ansver
Answers: 2

Another question on Biology

question
Biology, 22.06.2019 00:30
Which identifies the main purpose of biological taxonomy?
Answers: 3
question
Biology, 22.06.2019 02:00
2. given that most biochemical (other than coal) rocks react with hydrochloric acid, what does that tell you about organisms?
Answers: 1
question
Biology, 22.06.2019 09:20
Amap's orientation is typically determined by an
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
EASY POINTS
Why is "genetic blueprint" an appropriate description for DNA?...
Questions
question
Biology, 11.02.2021 21:00
question
Mathematics, 11.02.2021 21:00
Questions on the website: 13722366