1) If a messenger RNA has the sequence:
5’ AUGGCAUACGCAUUAUUGUCUGAGGAAUAAGAG 3'
a) What is th...
1) If a messenger RNA has the sequence:
5’ AUGGCAUACGCAUUAUUGUCUGAGGAAUAAGAG 3'
a) What is the corresponding sequence of the coding strand (DNA)?
b) What is the corresponding sequence of the template strand (DNA)?
c) What is each anticodon and what amino acid do the corresponding tRNA's carry?
d) What amino acid sequence would be translated from this mRNA fragment?
Answers: 3
Biology, 21.06.2019 21:00
My question says on my assignment. read the following scenarios and decide which of the properties of life are being described. the first one is. katherine stopped on the way to school to grab some donuts. 2. because a dog cannot sweat, it has to pant in order to stay cool. 3. an elephant trun had no bone but 4,000 muscles. i have no idea what i am supposed to anwer. i can't find the answer in my notes or book that i can understand anyway
Answers: 3
Biology, 22.06.2019 01:00
The picture shows a fishing technique called trawling. how might trawling affect marine biodiversity
Answers: 1
Biology, 22.06.2019 10:00
Suppose you use three different scale to weigh a bag of organges. one scale says the nag weighs 2.1 lb, and third says it weighs 2.1 lb. the actual weight of the bag of organges is 2.153 lb. which of the following best decribes these results?
Answers: 3
Mathematics, 13.04.2020 23:20
Mathematics, 13.04.2020 23:20
Law, 13.04.2020 23:20
Mathematics, 13.04.2020 23:20
Mathematics, 13.04.2020 23:20