1) If a messenger RNA has the sequence:
5β AUGGCAUACGCAUUAUUGUCUGAGGAAUAAGAG 3'
a) What is th...
1) If a messenger RNA has the sequence:
5β AUGGCAUACGCAUUAUUGUCUGAGGAAUAAGAG 3'
a) What is the corresponding sequence of the coding strand (DNA)?
b) What is the corresponding sequence of the template strand (DNA)?
c) What is each anticodon and what amino acid do the corresponding tRNA's carry?
d) What amino acid sequence would be translated from this mRNA fragment?
Answers: 3
Another question on Biology
Biology, 21.06.2019 18:40
Choose the molecule that is described by each phrase. energy used during long activities:
Answers: 2
Biology, 22.06.2019 00:00
Hurry which of these is true about index fossils? a) are very scarcely found b) used as guides in relative dating c) found in the youngest layer of the rock d) used as reference points in absolute dating
Answers: 2
Biology, 22.06.2019 04:00
The nervous system interacts with the endocrine system by a. using hormones as connections b. sending nerve impulses directly to glands c. using neuroendocrine cells as connections d. sending neurotransmitters directly to neurons
Answers: 1
Biology, 22.06.2019 05:30
2. sketch the inside of the bean nodule, and describe or label what you observed with the hand lens.
Answers: 2
You know the right answer?
Questions
History, 04.07.2019 04:30
History, 04.07.2019 04:30
Mathematics, 04.07.2019 04:30
Mathematics, 04.07.2019 04:30
Mathematics, 04.07.2019 04:30
Computers and Technology, 04.07.2019 04:30
Biology, 04.07.2019 04:30
History, 04.07.2019 04:30
History, 04.07.2019 04:30
History, 04.07.2019 04:30
Social Studies, 04.07.2019 04:30
History, 04.07.2019 04:30
