1) If a messenger RNA has the sequence: 5’ AUGGCAUACGCAUUAUUGUCUGAGGAAUAAGAG 3'
a) What is the corresponding sequence of the coding strand (DNA)?
b) What is the corresponding sequence of the template strand (DNA)?
c) What is each anticodon and what amino acid do the corresponding tRNA's carry?
d) What amino acid sequence would be translated from this mRNA fragment?

My question says on my assignment. read the following scenarios and decide which of the properties of life are being described. the first one is. katherine stopped on the way to school to grab some donuts. 2. because a dog cannot sweat, it has to pant in order to stay cool. 3. an elephant trun had no bone but 4,000 muscles. i have no idea what i am supposed to anwer. i can't find the answer in my notes or book that i can understand anyway

Name the part of the the brain labeled "e".

The picture shows a fishing technique called trawling. how might trawling affect marine biodiversity