During the binary fission of bacteria, what events must occur before the cell splits into two new cells?
Select all that apply.
A) Copies of the circular DNA molecule move to opposite ends of the cell.
B) A pilus is used to transfer DNA from one cell to the other.
C) The cell’s primary DNA molecule is copied.
D) Membrane-bound organelles are copied so that both cells get a set.
Answers: 2
Biology, 22.06.2019 04:00
Asolution of an enzyme and a substrate was placed in a water bath and the temperature of the reaction was raised gradually. the graph shown was plotted at the end of the experiment. what can be concluded from the graph? a) temperature has no effect on the activity of the enzyme. b) the effect of temperature on the enzyme is unpredictable. c) the enzyme shows increased activity up to a certain temperature. d) the activity of the enzyme is inversely proportional to the temperature.
Answers: 2
Biology, 22.06.2019 09:00
Were you able to observe the nucleolus in any of the cells if so which ones
Answers: 3
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 15:50
Which individual below would be considered heterozygous? a.dd b.dd c.dd
Answers: 2
During the binary fission of bacteria, what events must occur before the cell splits into two new ce...
Health, 14.02.2022 02:10
English, 14.02.2022 02:10
Mathematics, 14.02.2022 02:10
Biology, 14.02.2022 02:10
Mathematics, 14.02.2022 02:10
Social Studies, 14.02.2022 02:10
Computers and Technology, 14.02.2022 02:10
Physics, 14.02.2022 02:10
Mathematics, 14.02.2022 02:10
Mathematics, 14.02.2022 02:10