what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACCGTAACCACAACT and TACCTGTTAAGCTACTT?

Enzymes are proteins that speed up reactions by providing an additional energy source supplying additional molecules for the reaction removing inhibitors that slow down reactions lowering the amount of energy required

Many animals cannot sweat to maintain a stable body temperature. what is one other way animals can cool down?

Does masterbation affect height growth or loss of growth hormone?