What is the mRNA in TACCGGATGCCAGATCAAATC?

Well, Protein synthesis is the process in which cells make proteins. It occurs in two stages: transcription and translation. ... Translation occurs at the ribosome, which consists of rRNA and proteins. In translation, the instructions in mRNA are read, and tRNA brings the correct sequence of amino acids to the ribosome.

question: which statement best describes the different properties of metals?

answer: they are shiny and bend without breaking.

since metals have certain characteristics properties, they include the following: they are ductile, malleable, shiny, hard, lustrous, flexible and they are good conductor of heat and electricity. so therefore, metals are not dull and they are not non-flexible as listed. instead, they are shiny and flexible.

hope this , have a good day. c;