What is the complementary DNA of TACCGGATGCCAGATCAAATC?

Astudy by solloch and et. al., in 2017, gives the map above which shows the frequency of alleles with a ccr5-delta32 mutations over 87 different countries. this mutation deletes the presence of a co-receptor (ccr5) on the outside of human t-cells (lymphocytes). some viruses, such as the one responsible for the black death and human immunodeficiency virus (hiv), require this receptor for attachment to host cells during the infection process. the black death was an epidemic that passed over northern europe during the 14th century killing nearly 60% of europeans. according to this information, which explanation best explains why northern europeans show a greater immunity for hiv than some other parts of the world?