Biology, 14.04.2021 07:10 boxergirl2062
Predict Imagine you are colonizing another planet, and you want to grow plants
there as a food source. What do you need to bring, and what questions would you ask
about the planet in order to refine your list?
Answers: 1
Biology, 22.06.2019 01:30
Coat color in cats is determined by genes at several different loci. at one locus on the x chromosome, one allele (x ) encodes black fur and another allele (xo) encodes orange fur. females can be black (x x ), orange (xoxo), or a mixture of orange and black called tortoiseshell (x xo). males are either black (x y) or orange (xoy). bill has a female tortoiseshell cat named patches. one night, patches escapes from bill\'s house, spends the night out, and mates with a stray male. patches later gives birth to the following kittens: one orange male, one black male, two tortoiseshell females, and one orange female. what are the genotypes of patches, the stray male, and the kittens?
Answers: 3
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 17:30
What are some of the immune functions of the lymphatic system? a. cleaning red blood cells from the blood and creating lymph fluids b.transporting lymph to the tissues and creating lymph fluids c.removing infectious agents and making white blood cells d.making red blood cells and removing infectious agents
Answers: 1
Biology, 22.06.2019 23:30
Which of the following best explains the changes in biodiversity shown in the graph?
Answers: 1
Predict Imagine you are colonizing another planet, and you want to grow plants
there as a food sour...
Mathematics, 21.06.2020 03:57
Computers and Technology, 21.06.2020 03:57
Mathematics, 21.06.2020 03:57
Mathematics, 21.06.2020 03:57
Chemistry, 21.06.2020 03:57
Arts, 21.06.2020 03:57
Computers and Technology, 21.06.2020 03:57
Mathematics, 21.06.2020 03:57