subject
Biology, 13.04.2021 17:10 swaggernas

What is deposition ?​

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 02:30
Which of these is most likely to happen if parallax measurements of star distances are taken after a gap of six months? the results would be accurate the results would be inconsistent the results would not be valid the results would not be repeated
Answers: 1
question
Biology, 22.06.2019 04:20
Do you think the gene eef1 alpha1 supports cell theory? explain your response.
Answers: 2
question
Biology, 22.06.2019 08:10
In sweet pea, gene c is responsible for color production and gene p is responsible for the purple color pigment. both of them are located on two different loci on different chromosomes. the flowers will be purple only when the plant has the genotypes as c_p_. no color will be produced with genotypes: ccpp, ccpp, ccpp, ccpp. thus, gene c controls the expression of gene p. what pattern of inheritance is exhibited here? a. pleiotropy b. epistasis c. multiple alleles
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
What is deposition ?​...
Questions
question
English, 23.03.2020 12:08
question
Mathematics, 23.03.2020 12:09
question
Mathematics, 23.03.2020 12:12
question
Mathematics, 23.03.2020 12:14
question
Mathematics, 23.03.2020 12:25
Questions on the website: 13722359