Biology, 08.04.2021 01:00 cuppykittyy
The immune response generates some side effects that can be unpleasant. what their potential benefits could be?
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 12:40
Which of the following best describes the expensive tissue hypothesis? brains require more energy, so the gut had to be reduced, and larger brains and tool use led to higher quality diets. increasing body size means that homo neanderthalensis had to include more fat in its diet. brains require more energy, so the gut had to be reduced as brains got bigger. brains require more fat, so the gastrointestinal viscera (gut) had to expand, and hands were needed to acquire more food.
Answers: 1
Biology, 22.06.2019 21:30
Anurse administers methenamine cautiously to a client with a history of which condition?
Answers: 1
Biology, 23.06.2019 01:30
Hich is an example of using comparative anatomy to study evolutionary relationships? comparing and contrasting the dna of two organisms studying the digestive system structure in two organisms using ancient footprints to learn about an organism’s behaviors looking at the development of a fertilized egg of an organism
Answers: 1
The immune response generates some side effects that can be unpleasant. what their potential benefit...
Mathematics, 11.03.2020 23:34