![subject](/tpl/images/cats/biologiya.png)
Which of the following statements best summarize protein production in cells? A ribosome, messenger RNA, transfer RNA and amino acids produce protein on the rough endoplasmic reticulum The messenger RNA is a copy of a segment of DNA. O A ribosome, messenger RNA, and amino acids produce protein on the smooth endoplasmic reticulum. O The chromosomes provide the protein that is used by the ribosomes to build DNA on the endoplasmic reticulum​
![ansver](/tpl/images/cats/User.png)
Answers: 3
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 21:30
Now it's your turn to investigate human impact around the world. grab your virtual lab coat and put on your environmental science hat. you will be taking a trip around the globe to explore three locations. at each location, you will investigate the cause and effect relationships of deforestation, desertification, and urbanization. you will also gather evidence of how these factors have impacted the environment over time
Answers: 1
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
You know the right answer?
Which of the following statements best summarize protein production in cells? A ribosome, messenger...
Questions
![question](/tpl/images/cats/mat.png)
Mathematics, 09.07.2021 05:50
![question](/tpl/images/cats/fizika.png)
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/istoriya.png)
History, 09.07.2021 05:50
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 09.07.2021 05:50
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/istoriya.png)
History, 09.07.2021 05:50
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 09.07.2021 05:50
![question](/tpl/images/cats/fizika.png)
Physics, 09.07.2021 05:50
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/himiya.png)
Chemistry, 09.07.2021 05:50
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/istoriya.png)
History, 09.07.2021 05:50
![question](/tpl/images/cats/himiya.png)
Chemistry, 09.07.2021 05:50
![question](/tpl/images/cats/ap.png)
Advanced Placement (AP), 09.07.2021 05:50
![question](/tpl/images/cats/mat.png)
Mathematics, 09.07.2021 05:50