The image, in which A represents a gene, shows a harmless mutation that has occurred in a species' genome. Which is the most
plausible way that this mutation may eventually benefit the species?
A)
Multiple copies of genes increase gene expression and protein synthesis,
improving fitness
B) One copy of the gene may mutate further and begin to function differently
from the original.
C) Individuals with different copy numbers of the gene will not be able to
mate, resulting in speciation.
D) Individuals with the mutation are not able to produce offspring and will be removed from the gene pool.
Answers: 2
Biology, 21.06.2019 22:30
How can you approximate the number of calories required to keep you in energy balance?
Answers: 2
Biology, 22.06.2019 06:30
Ascientist is examinin the cell is disrupted when she damages one specific type of macromolecule g the function of macromolecules in a cell she notices that movenent of large molecules into and out of
Answers: 1
Biology, 22.06.2019 11:20
Archeologists have discovered three sites showing conclusive evidence for the mastery of fire in tanzania, from a period slightly after the time that homo habilis was present in africa. these sites clearly were founded by homo erectus, the descendent species of homo habilis that migrated north, out of africa and into asia. homo erectus was known to have mastered fire, from ample evidence at sites in asia. there is no reason to attribute mastery of fire to homo ergaster, the descendent species of homo habilis that remained in africa.which of the following is an assumption on which the argument depends? (a) before their migration, homo erectus occupied african territory as far south as tanzania.(b) the strain of migration provided the selective pressure motivating homo erectus‘ mastery of fire.(c) homo ergaster would not have derived as much benefit from the mastery of fire as did homo erectus.(d) homo ergaster inherited all cultural knowledge from homo habilis, a species that did not have mastery of fire.(e) homo ergaster did not occupy regions as far south as tanzania until well after the time of these three sites.
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
The image, in which A represents a gene, shows a harmless mutation that has occurred in a species' g...
Advanced Placement (AP), 19.10.2021 14:00
Chemistry, 19.10.2021 14:00
Mathematics, 19.10.2021 14:00
Mathematics, 19.10.2021 14:00
Mathematics, 19.10.2021 14:00
Biology, 19.10.2021 14:00
Mathematics, 19.10.2021 14:00
Business, 19.10.2021 14:00
English, 19.10.2021 14:00