18 7
1 point
Given the DNA template strand below type the complementary mRNA that would be made during transcription.
13
CCAGTAATGACTTCGATGCA
type your answer...

Ooo thats a DNA strand DNA strands code what you look like what gender you are and how tall you are etc

Explanation:

answer: grassland biomes are closer to the equator and receive more rain.

grasslands are biomes that are dominated by grasses rather shrubs and trees. savanna are biomes that exhibit grasses, shrubs and small tree as vegetation. grasslands are located near the equator of the earth. these are found in north america. savanna biomes are found in africa, south america, australia and india. grassland exhibit moderate climatic conditions, it receives   amount of rainfall higher than savanna.   therefore, savanna exhibit dry and hot climatic conditions.