subject
Biology, 25.03.2021 23:30 janely6017

What type of heat transfer occurs through direct contact? A. conduction

B. convection

C. radiation

D. nuclear ​

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 06:30
Guard cells control which event? the growth of plants capture of solar energy gas exchange in leaves water absorption in roots
Answers: 1
question
Biology, 22.06.2019 08:00
Explain why biological control methods are generally environmentally superior to chemical pest control methods.
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 12:30
If a checkpoint detects damaged dna, the checkpoint may
Answers: 1
You know the right answer?
What type of heat transfer occurs through direct contact? A. conduction

B. convection
Questions
question
Mathematics, 27.09.2020 14:01
question
Social Studies, 27.09.2020 14:01
question
Mathematics, 27.09.2020 14:01
question
Physics, 27.09.2020 14:01
Questions on the website: 13722359