Fill in the corresponding mrna sequence of the dna strand: atgcgctgcacgtgcacgtt
tacgcgacgtgcacgtgcaa

Assume that you are interested in separating short (200-400 bp) dna molecules from a pool of longer molecules in the 10,000-20,000 nucleotide range. you have two recipes for making your polyacrylamide gels: one recipe uses 1.5 percent agarose and would be considered a “hard gel,” while the other uses 0.5 percent agarose and would be considered a loose gel. which gel should you use to separate the short (200-400 bp) dna molecules from a pool of longer molecules in the 10,000-20,000 nucleotide range?