How many organs are in the digestive systems​

Which statement best describes the relationship between an allele and a gene? question 1 options: an allele is a variation of a gene that can be expressed as a phenotype. an allele is the part of a gene that attaches to messenger rna molecules. an allele is a segment of a dna molecule that controls replication of a gene.

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

During crossing-over, a. genetic material is exchanged between nonsister chromatids, resulting in new combinations of alleles. b. nonsister chromatids from each homologous chromosome of a tetrad are exchanged, resulting in new combinations of alleles. c. one homologous chromosome of a tetrad is exchanged with another tetrad, resulting in new combinations of alleles. d. sister chromatids from each homologous chromosome of a tetrad are exchanged, resulting in new combinations of alleles. e. genetic material is exchanged between sister chromatids, resulting in new combinations of alleles.