Answers: 3
Biology, 22.06.2019 03:30
Q: a: in sexually reproducing animals, once fertilization of the egg takes place, the exists as a single cell until cell division begins
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 13:10
Match the correct terms to their descriptions a system in which only energy but not matter is exchanged frozen water in snow part of geosphere that includes only soil a thin layer between the troposphere and the stratosphere cryosphere tropopause closed system pedosphere
Answers: 2
A bacterial cell that makes a protein normally found in spider venom
because it has a spider gene w...
Mathematics, 14.02.2020 09:15
Spanish, 14.02.2020 09:16
Mathematics, 14.02.2020 09:16
Mathematics, 14.02.2020 09:18
English, 14.02.2020 09:18
Mathematics, 14.02.2020 09:18
Social Studies, 14.02.2020 09:19
French, 14.02.2020 09:19
English, 14.02.2020 09:20
Mathematics, 14.02.2020 09:21