Select all the correct answers. Evolution never occurs in a straight line. There are always branches and nodes that can be seen along the way. Based on the image, which two
statements are true?
orangutan gonilla
48 chromosomes 48 chromosomes
(24 pars) (24 pairs)
chimpanzee
48 chromosomes
(24 pairs)
bonobo
48 chromosomes
(24 pairs)
human
46 chromosomes
(23 pairs)
Present
3 million years ago
8 million years ago
8 million years ago
13 milion years ago
All organisms have had one common ancestor in the past.
O Chimpanzees are more evolved than all other organisms.
0 Gorillas share an extinct ancestor with banabos.
Chimpanzees are unrelated to orangutans or humans.
0 Orangutans are unrelated to gorillas or bonobos.

All cells have the same genetic information, but do not express the same genes. how is this possible? question 10 options: the differences are due to gene expression, which can be turned on and off. genetic material in a muscle cell is completely different from genetic material in a skin cell. genetic material is the same in all cells in the human body, except for reproductive cells. differences are due to major changes in genetic information from cell to cell.

Select the correct answer. a chestnut-colored horse mates with a white-colored horse to produce a brown and white spotted offspring. what is the type of inheritance pattern?

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?