Match the terms to their definition.
1 evolution
evolution above the species level
2. l...
Biology, 10.03.2021 18:10 luisgonz5050
Match the terms to their definition.
1 evolution
evolution above the species level
2. lineage
3. macroevolution
the expression of a genetic trait, or
what the trait looks like
genetic change in a population or
species over many generations
evolution at or below the species
level
4. microevolution
5. phenotype
group of related organisms that
share features and characteristics
continuous line of descent
6. species
Answers: 1
Biology, 21.06.2019 13:30
One function of the poly-a tail on eukaryotic mrna sequences is to the mrna be transported from the nucleus to the cytoplasm. prokaryotic mrna also has a poly-a tail. choose the best explanation of the prokaryotic poly-a tail. a. prokaryotic poly-a tails have the same functions as eukaryotic poly-a tails, because this process is highly conserved throughout different species. b. prokaryotic poly-a tails aren't important, because prokaryotes don't have nuclei. c. prokaryotic poly-a tails have other functions, because prokaryotes don't have nuclei. d. prokaryotic poly-a tails are composed of a different molecular structure compared with eukaryotic poly-a tails.
Answers: 3
Biology, 21.06.2019 23:30
The energy available as a result of the motion of a body is called energy. -potential -gravitational -kinetic -chemical
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 13:50
Interactions between organisms and their environment impact the organism’s overall population. the jaguar panthera onca is the largest cat in north america. it is found in areas across the southwest, including arizona, new mexico, and texas. it is a carnivore that has powerful jaws and sharp teeth and preys on fish, turtles, tapirs, and many smaller mammals. which shows the relationship between the jaguar and turtles?
Answers: 3
Social Studies, 04.11.2020 02:00
Mathematics, 04.11.2020 02:00
Mathematics, 04.11.2020 02:00
Physics, 04.11.2020 02:00
Mathematics, 04.11.2020 02:00
History, 04.11.2020 02:00
Geography, 04.11.2020 02:00
Computers and Technology, 04.11.2020 02:00
Mathematics, 04.11.2020 02:00
History, 04.11.2020 02:00
Social Studies, 04.11.2020 02:00
Geography, 04.11.2020 02:00
Biology, 04.11.2020 02:00