Biology, 02.03.2021 14:00 hopeschr2019
Homeostasis can be disrupted by many factors. External stimuli that can disrupt homeostasis include & outside temperature. Internal stimuli include
& water concentration.
A) pathogens, blood pressure
B) blood pressure, pathogens
C) insulin production in body, toxins
D) toxins, insulin production in body
Answers: 3
Biology, 22.06.2019 00:30
Imagine that certain laws of physics could be ignored and you were able to travel vast distances in moments. now imagine that you traveled to an earth-like planet located light-years away that is known to support life. think about what you’ve learned in this unit and make an argument for what you think would be the dominant type of life form on this planet. consider whether a notochord is required for an organism to manipulate its environment and become a dominant creature.
Answers: 3
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 14:10
Select the correct answer.what is the observable characteristic of a person called? o a. genotypephenotypeoc.alleleo d.gene
Answers: 2
Homeostasis can be disrupted by many factors. External stimuli that can disrupt homeostasis include...
Chemistry, 03.12.2021 02:10
Mathematics, 03.12.2021 02:10
Business, 03.12.2021 02:10
English, 03.12.2021 02:10
French, 03.12.2021 02:10