Help please asap
Directional selection differs from stabilizing selection in that:
a....
![subject](/tpl/images/cats/biologiya.png)
Biology, 23.02.2021 22:50 danielzgame
Help please asap
Directional selection differs from stabilizing selection in that:
a. Directional selection favors one extreme phenotype, whereas stabilizing selection favors intermediate over extreme phenotypes
b. Directional selection requires new mutations whereas stabilizing selection uses existing variation
c. Directional selection operates only in small populations, whereas stabilizing selection only works in large populations
d. they both do nothing, these are terms I made up while writing this retake
![ansver](/tpl/images/cats/User.png)
Answers: 2
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 10:40
Which of the following factors would not contribute to allopatric speciation? a) a population becomes geographically isolated from the parent population.b) the separated population is small, and genetic drift occurs.c) the isolated population is exposed to different selection pressures than the ancestral population.d) different mutations begin to distinguish the gene pools of the separated populations.e) gene flow between the two populations is extensive.
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 15:00
Which of th following is needed for cellular respiration to occur
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 15:20
What is required in the genotype of an individual to show a recessive trait? a.two recessive alleles b.at least one recessive allele c.no recessive alleles
Answers: 2
You know the right answer?
Questions
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/en.png)
English, 24.02.2021 20:40
![question](/tpl/images/cats/mat.png)
Mathematics, 24.02.2021 20:40
![question](/tpl/images/cats/istoriya.png)
History, 24.02.2021 20:40
![question](/tpl/images/cats/mat.png)
Mathematics, 24.02.2021 20:40
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 24.02.2021 20:40
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/informatica.png)
Computers and Technology, 24.02.2021 20:40
![question](/tpl/images/cats/en.png)
English, 24.02.2021 20:40
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 24.02.2021 20:40
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 24.02.2021 20:40
![question](/tpl/images/cats/geografiya.png)
Geography, 24.02.2021 20:40
![question](/tpl/images/cats/mat.png)
Mathematics, 24.02.2021 20:40
![question](/tpl/images/cats/mat.png)
Mathematics, 24.02.2021 20:40
![question](/tpl/images/cats/mat.png)
Mathematics, 24.02.2021 20:40