20 points Giving this information:

DNA Codons: ATG GCC TTT CTG GCC TGA

DNA Anticodons: TAC CGG AAA GAC __ __

Transcription mRNA:

Amino Acid Sequence Translation: ​

What is turgor pressure, what causes it, and what does it do for a plant?

2. cheryl hears a new song on the radio every day during the week on her commute to work. surprisingly, when the song comes on at a party on saturday night, she knows most of the words without trying. describe the three ways that we use cognition to learn without reinforcement. which type of cognitive learning without reinforcement best explains how cheryl knew the song lyrics? explain your answer.

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?