subject
Biology, 16.02.2021 19:50 PONBallfordM89

Explain why housing development by people would increase or decrease the carrying capacity of ALL the organisms. *
Your answer

ansver
Answers: 2

Another question on Biology

question
Biology, 22.06.2019 07:30
Directions: read the descriptions of the four islands presented in the lesson. 1. list two new traits that each new species of rat might demonstrate as it adapts to the conditions on each island. 2. introduce one of the four new rat species to another island and describe one challenge it would encounter and one success as it adapts to its new environment.
Answers: 2
question
Biology, 22.06.2019 10:30
A(n) is a molecule influences the way that a molecule reacts.
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 18:30
Match the enzymes to their role in the dna replication process
Answers: 1
You know the right answer?
Explain why housing development by people would increase or decrease the carrying capacity of ALL t...
Questions
question
Physics, 11.11.2020 21:40
question
Biology, 11.11.2020 21:40
question
Social Studies, 11.11.2020 21:40
question
Mathematics, 11.11.2020 21:40
question
Mathematics, 11.11.2020 21:40
question
Mathematics, 11.11.2020 21:40
Questions on the website: 13722367