2
DNA: TTTACGGCCATCAGGCAATACTGG
mRNA:
Codon:
Anitcodon:
Amino Acids:

Female luna moths (actias luna) attract males by emitting chemical signals that spread through the air. a male hundreds of meters away can detect these molecules and fly toward their source. the sensory organs responsible for this behavior are the comblike antennae visible in the photograph shown here. each filament of an antenna is equipped with thousands of receptor cells that detect the sex attractant. based on what you learned in this chapter, propose a hypothesis to account for the ability of the male moth to detect a specific molecule in the presence of many other molecules in the air. what predictions does your hypothesis make? design an experiment to test one of these predictions.