Answers: 2
Biology, 22.06.2019 03:00
Nhumans, abo blood types refer to glycoproteins in the membranes of red blood cells. there are three alleles for this autosomal gene: ia, ib, and i. the ia allele codes for the a glycoprotein, the ib allele codes for the b glycoprotein, and the i allele doesn't code for any membrane glycoprotein. ia and ib are codominant, and i is recessive to both ia and ib. people with type a blood have the genotypes iaia or iai, people with type b blood are ibib or ibi, people with type ab blood are iaib, and people with type o blood are ii. if a woman with type ab blood marries a man with type o blood, which of the following blood types could their children possibly have? in humans, abo blood types refer to glycoproteins in the membranes of red blood cells. there are three alleles for this autosomal gene: ia, ib, and i. the ia allele codes for the a glycoprotein, the ib allele codes for the b glycoprotein, and the i allele doesn't code for any membrane glycoprotein. ia and ib are codominant, and i is recessive to both ia and ib. people with type a blood have the genotypes iaia or iai, people with type b blood are ibib or ibi, people with type ab blood are iaib, and people with type o blood are ii. if a woman with type ab blood marries a man with type o blood, which of the following blood types could their children possibly have? a, b, ab, and o ab and o a, b, and o a and b
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
I need some help here now ASAP
...
...
Mathematics, 28.01.2020 21:04
Mathematics, 28.01.2020 21:04
Mathematics, 28.01.2020 21:04
Mathematics, 28.01.2020 21:04
Chemistry, 28.01.2020 21:04
Mathematics, 28.01.2020 21:04
Mathematics, 28.01.2020 21:04