subject
Biology, 04.01.2021 16:30 ashah1260

Match the types of planters with their use. Drill planters> [ ]

Broadcast planters> [ ]

Row crop planters> [ ]

Here are the answers for those.

Used to place seeds in narrow rows at high rates of speed.

used to plant seeds in random patterns.

used to place seeds with even spacing.

ansver
Answers: 3

Another question on Biology

question
Biology, 21.06.2019 14:30
Which are observations about the tree on the right ,? check all that apply
Answers: 2
question
Biology, 22.06.2019 10:00
Asegment of dna that codes for rna and a protein is a
Answers: 3
question
Biology, 22.06.2019 10:30
Which statement best describes a typical difference that could be found between the “analysis” and “conclusion” sections of a lab report?
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Match the types of planters with their use. Drill planters> [ ]

Broadcast planters>...
Questions
question
History, 29.07.2019 06:00
question
English, 29.07.2019 06:00
Questions on the website: 13722365