Materials in cells may be transported by passive or active processes, both of which may involve concentration gradients, the phospholipid bilayer, and membrane proteins. Part A: Compare the role of concentration gradients in passive and active transport. Part B: Compare the role of the phospholipid bilayer in passive and active transport. Part C: Compare the role of membrane proteins in passive and active transport.
Answers: 3
Biology, 22.06.2019 11:30
According to theories of how life began, how did early organic molecules begin to separate from the outside world? a: specialized enzymes were required b: chains of amino acids created a barrier c: formation of microspheres or vesicles d: rna catalyzed the formation of membranes
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 12:30
If a cell is placed into a hypertonic environment,what will happen to it ? a)it will shrink or shrivel b)nothing c)it will burst d) it will expand or enlarge
Answers: 1
Biology, 22.06.2019 14:40
Both destructive and constructive, the natural event seen here, is important in destroying and creating landforms on earth. what is this event called? a) deposition b) flooding c) landslide d) sedimentation
Answers: 2
Materials in cells may be transported by passive or active processes, both of which may involve conc...
History, 09.02.2021 09:20
Mathematics, 09.02.2021 09:20
Mathematics, 09.02.2021 09:20
Physics, 09.02.2021 09:20
Mathematics, 09.02.2021 09:20
English, 09.02.2021 09:20
Mathematics, 09.02.2021 09:20
Arts, 09.02.2021 09:20