Biology, 17.12.2020 21:10 trujillo03
(10 points) Marine Biology. needed as soon as possible
Match the kelp ecosystem to the organisms that reside there.
1. oarweed
2. nudibranch
3. sponge
4. otter
5. sea urchin
6. rockfish
match each one to its ecosystem,
Ecosystem 1: Kelp Canopy
Ecosystem 2: intermediate Region
Ecosystem 3: Dark Seafloor
Answers: 3
Biology, 21.06.2019 23:40
Which statement describes an endocrine function rather than an exocrine function? a. salivary glands release saliva into the mouth. b. sweat glands release sweat onto the skin c. the pineal gland releases melatonin into the blood. d. esophageal glands release mucus into the esophagus.
Answers: 1
Biology, 22.06.2019 05:30
Which of the following is a good strategy when it comes to desserts
Answers: 3
Biology, 22.06.2019 08:50
What processes take place before the mature mrna exits the nucleus?
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
(10 points) Marine Biology. needed as soon as possible
Match the kelp ecosystem to the organisms th...
History, 23.06.2019 08:30
History, 23.06.2019 08:30
Mathematics, 23.06.2019 08:30
Mathematics, 23.06.2019 08:30
Business, 23.06.2019 08:30
History, 23.06.2019 08:30
Mathematics, 23.06.2019 08:30
History, 23.06.2019 08:30
History, 23.06.2019 08:30
Social Studies, 23.06.2019 08:30
Mathematics, 23.06.2019 08:30
Biology, 23.06.2019 08:30