subject
Biology, 12.12.2020 16:10 coolkason

Please help! I’ll mark brainliest


Please help! I’ll mark brainliest

ansver
Answers: 3

Another question on Biology

question
Biology, 21.06.2019 15:00
Always use significant figure rules. remember that these rules apply to all numbers that are measurements. if a vector that is 3 cm long represents 30 km/h, what velocity does a 5 cm long vector which is drawn using the same scale represent? a.100 km/h b.60km/h c.50km/h
Answers: 2
question
Biology, 22.06.2019 09:00
What substance is the most acidic. lemon juice. tomato juice. sodium hydroxide. water
Answers: 1
question
Biology, 22.06.2019 11:30
Which organism can most likely be classifild as domain bateria
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Please help! I’ll mark brainliest
...
Questions
question
Mathematics, 23.10.2019 04:00
question
Mathematics, 23.10.2019 04:00
question
Social Studies, 23.10.2019 04:00
Questions on the website: 13722363