What is the complementary dna sequence to
atg atc cga atg agc gcc gat aag ttg cag tag...
Biology, 08.12.2020 17:50 jacquetpaul1969
What is the complementary dna sequence to
atg atc cga atg agc gcc gat aag ttg cag tag
Answers: 2
Biology, 21.06.2019 18:30
Select all the correct answers. lactobacillus is a bacteria that live inside humans. these bacteria live on the nutrients from our bodies. they to keep our gut clean and healthy. s. typhi is a bacteria that enter our bodies through contaminated food. this bacteria causes infections in the body. based on this information, which two statements about the association between these bacteria and humans are true? a. lactobacillus shares a parasitic relationship with humans. b. s .typhi shares a parasitic relationship with humans. c. both lactobacillus and s. typhi share a parasitic relationship with humans. d. both lactobacillus and s. typhi share a mutualistic relationship with humans. e. lactobacillus shares a mutualistic relationship with humans, and s. typhi shares a parasitic relationship multiply chrse
Answers: 1
Biology, 22.06.2019 03:20
Which food could be transported in a galvanized metal container?
Answers: 2
Biology, 22.06.2019 07:30
Directions: read the descriptions of the four islands presented in the lesson. 1. list two new traits that each new species of rat might demonstrate as it adapts to the conditions on each island. 2. introduce one of the four new rat species to another island and describe one challenge it would encounter and one success as it adapts to its new environment.
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Mathematics, 10.06.2021 01:20
History, 10.06.2021 01:20
Arts, 10.06.2021 01:20
Mathematics, 10.06.2021 01:20
Mathematics, 10.06.2021 01:20
Mathematics, 10.06.2021 01:30
Mathematics, 10.06.2021 01:30
Mathematics, 10.06.2021 01:30