Robert is studying a long list of letters. The letters represent the order of nitrogenous bases in a molecule of mRNA. The first several bases in the list are shown below. AUGCCACAGGUUCAUCCGAA…

To identify the amino acid sequence encoded by the mRNA, which would be the most useful first step for Robert to follow?

A. Calculate the frequencies of each letter.
B. Count the number of letters in the list.
C. Separate the list into three-letter "words."
D. Separate the list into two-, three- and four-letter "words."

Johannesburg kepler, an apprentice of brahe, believed in the heliocentric universe but rejected past astronomers belief in

In 1959, doctors began using the powerful antibiotic methicillin to treat infections of staphylococcus aureus, but within two years, methicillin-resistant strains of s. aureus (mrsa) appeared. how did the resistant strains of s. aureus emerge? in 1959, doctors began using the powerful antibiotic methicillin to treat infections of staphylococcus aureus, but within two years, methicillin-resistant strains of s. aureus (mrsa) appeared. how did the resistant strains of s. aureus emerge? staphylococcus aureus bacteria that were able to synthesize cell walls using a protein that was not affected by methicillin survived the methicillin treatments and reproduced at higher rates than did other individuals. over time, these resistant individuals became increasingly common. in response to treatment of staphylococcus aureus infections with methicillin, some bacteria began to synthesize cell walls using a protein that was not affected by methicillin. these bacteria survived the methicillin treatments and reproduced at higher rates than did other individuals. over time, these resistant individuals became increasingly common. in response to treatment of staphylococcus aureus infections with methicillin, bacterial populations gradually began to synthesize cell walls using a protein that was not affected by methicillin.

What is the name of the type of cell division that occurs in the prokaryotic cell cycle