In cattle, black coat, B, is dominant to red coat (b). Hornless, H, is dominant to horned (h). A certain bull was mated to four cows. Cow 1, black and hornless, gave birth to a red, hornless calf. Cow 2, red and hornless, gave birth to a black, horned calf. Cow 3, black and horned, gave birth to a red, horned calf. Cow 4, red and horned, gave birth to a black, hornless calf. What is the genotype of the bull? What are the possible genotypes of each of the cows and their calves? Please help, its worth a lot, and the last person that "helped" me just made up an answer :( I have no idea how to do it. I will mark brainliest.

Use the above pedigree for questions 1,2, and 3 1. what kind of genetic disorder is represented in the pedigree? a. recessive b. dominate refer to the pedigree in question 1. 2. is the mutated gene in this disorder located on a sex chromosome (x or y) or an autosome? a. sex chromosome b. autosome refer to the pedigree in question 1. 3. which generation has individuals that you are certain are heterozygous for the mutated gene? a. generation 1 b. generation 2 c. generation 3

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Describe the change in phase and temperature as water moves from the oceans to the atmosphere and then returns to earth again as rain. a) evaporation : temperature increases; condensation : temperature decreases; precipitation (rain) : temperature decreases b) evaporation : temperature increases; condensation : temperature decreases; precipitation (rain) : temperature increases c) evaporation : temperature decreases; condensation : temperature decreases; precipitation (rain) : temperature decreases d) evaporation : temperature increases; condensation : temperature increases; precipitation (rain) : temperature decreases